A method to improve the sensitivity of nucleic acid detection of COVID-19, taking Trizol reagent as an example

In the past period of time, the world has experienced an unprecedented disaster (COVID-19). Of course, it is still going on. This affects the lives of people in every corner of the earth and makes us very scared. In order to reduce our sense of fear, let us learn more about the "new coronavirus nucleic acid test" that is constantly mentioned at the press conference.

First, share the primers and probe sequences released by the Chinese Center for Disease Control and Prevention to detect the new coronavirus:

It is recommended to use primers and probes for the open reading frame 1ab (open reading frame, ORF1ab) and nucleoprotein (N) gene region of the new coronavirus.

Target 1 (ORF1ab):

Forward primer (F): CCCTGTGGGTTTTACACTTAA

Reverse primer (R): ACGATTGTGCATCAGCTGA

Fluorescent probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'

Target 2 (N):

Forward primer (F): GGGGAACTTCTCCTGCTAGAAT

Reverse primer (R): CAGACATTTTGCTCTCAAGCTG

Fluorescent probe (P): 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'

After synthesizing the primer probes according to the information provided by the Center for Disease Control and Prevention, buy a Simgen-like 2×One Step Probe RT-PCR Mix (Cat. No. 406100) premixed RT-PCR reagent, you can make your own new coronavirus nucleic acid detection The kit is out. But here comes the problem. Nucleic acid detection consists of two parts: nucleic acid extraction + PCR detection. Only RT-PCR reagents are not enough. For viral RNA detection, viral RNA extraction is the highlight of nucleic acid detection: because of the virus in the sample. The amount of RNA is usually low (pg level) and easily degraded. The extraction process is time-consuming and laborious, so that the recovery efficiency of viral RNA directly determines the sensitivity of detection. Therefore, some irresponsible nucleic acid diagnostic reagent manufacturers have adopted evasion. Method: Only provide fluorescent PCR detection reagents, let users find the nucleic acid extraction method by themselves...Well, if you are unlucky and need to choose the virus nucleic acid extraction method yourself, this article should be very valuable, we use the most common laboratory Trizol reagent to extract viral RNA.

一、Samples, reagents and instruments

1. The hepatitis C virus positive serum, provided by the laboratory of a hospital, has been tested by Daan Gene's Hepatitis C Virus (HCV) Nucleic Acid Detection Kit (PCR-Fluorescent Probe Method). The virus concentration is 105 copies/ml.

Dilute 105 copies/ml of hepatitis C virus positive serum by 10 times with mixed human negative serum to obtain 104 copies/ml of serum; then use mixed human negative serum to dilute 104 copies/ml of hepatitis C virus positive serum by 10 times to obtain 103 copies/ml serum.

2. Simgen virus nucleic acid purification kit (Cat. No. 4002050), Simgen Trizol reagent (Cat. No. 5301100), Simgen Carrier RNA (Cat. No. 4003101)

3. HCV detection kit: Acon hepatitis C virus nucleic acid quantitative determination kit (PCR-fluorescence method)

4. PCR instrument: ABI PRISM® 7000 Sequence Detection System

5. Centrifuge: Thermo Biofuge pico

二、Test method

1. Use Simgen virus nucleic acid purification kit, Trizol plus Carrier RNA, and Trizol reagent to separate and purify viral RNA in the same tube of 103 copies/ml serum samples. (Trizol extraction method: 1ml Trizol reagent/1ml Trizol reagent containing 3 μl Carrier RNA + 200 μl serum mix → + chloroform mix → centrifuge to take 750 μl supernatant + 600 μl isopropanol → centrifuge and wash with 75% ethanol → Dissolve in 50 μl RNase-free water, please fill in your own brain for details)

2. The three methods are used to separate and purify viral RNA from 200 μl of serum each time. Make two tubes each. The final elution/dissolution volume of RNA is 50 μl.

3. The viral RNA obtained by the three viral RNA extraction methods are all amplified with 10 μl as a template, and the final reaction volume is 40 μl, using the same batch of Acon hepatitis C virus nucleic acid quantitative determination kit (PCR-fluorescence method) Amplification. (Note: Acon Hepatitis C Virus Nucleic Acid Quantitative Determination Kit (PCR-Fluorescence Method) The actual number of RT-PCR cycles is 45 cycles, and the reaction conditions are as follows: 42℃ 30min, 95℃ 3min, [95℃ 10sec, 55℃ 30sec , 72℃ 1min (5 cycles)], [95℃ 5sec, 60℃ 32sec (40 cycles)])

三、Experimental results

1. Add 10 μl of water as a template to the negative control of the reaction system, and the test result is negative.

See picture one

2. The 103copies/ml serum samples extracted by different methods, the test results are as follows:

See picture two

四、Analysis and discussion

1. Judging from the test results, the Trizol reagent is still amplifying after all, but the CT value is very large, so it's gone. After Trizol reagent was added with Carrier RNA, the starting line was normal. But it is almost two CT values larger than the viral nucleic acid purification kit.

2. Trizol reagent is difficult to start when extracting 103 copies/ml serum samples. We are very worried about whether it will be able to start when extracting 102 copies/ml serum samples. So I recommend those who advertise their products with a detection sensitivity of up to 102 copies/ ML manufacturers, do you want to restrict the supporting virus nucleic acid extraction methods, otherwise there will be suspicion of false publicity. Nowadays, there are also frequent debates in the news about why the new coronavirus nucleic acid detection method has false negatives. I personally think that due to the particularity of viral RNA samples, the sampling method and storage conditions of throat swab samples, and nucleic acid extraction, every link has It may affect the sensitivity of subsequent PCR testing. Therefore, the National Food and Drug Administration should give priority to products containing viral nucleic acid extraction reagents when approving new coronavirus nucleic acid detection kits. Only products provided by such companies will have relatively high test results. The stability.

3. After adding Carrier RNA to Trizol reagent, the starting line is almost qualitatively overflew, how to explain? In fact, it is simple: the precipitation efficiency of pg-level viral RNA is too low, but after adding μg-level Carrier RNA to the purification system, the efficiency of precipitation of viral RNA is not the same level at all. Let's look at the photos together:

See picture three

Everyone knows that RNA is much more fragile than DNA and is easily degraded. Of course, the powerful RNase that does not inactivate at 100°C is the culprit. When Carrier RNA is present, it is also of great significance to protect viral RNA from being attacked by RNase. of. The viral RNA amplification curve extracted by Trizol reagent falls down, which does not rule out the possibility that the viral RNA is degraded, causing amplification difficulties.

4. Although the Trizol reagent has a much better start after adding Carrier RNA, it is still two CT values ​​larger than the viral nucleic acid purification kit, which means that the efficiency of the viral nucleic acid purification kit to extract viral RNA is Trizol reagent + Carrier RNA How do you explain it? This starts with the principle of RNA extraction with Trizol reagent: Trizol is a mixture of guanidine thiocyanate + phenol + acetic acid, guanidine thiocyanate is responsible for denaturing solubilized proteins (the most valuable for virus particles is the solubilizing protein shell); phenol is responsible for extraction Denatured protein; Acetic acid is responsible for maintaining a low pH and ensuring that the DNA remains in an insoluble state. First, in the process of dissolving virus particles, the efficiency of dissolving protein (virus particles) with guanidine salt is lower than that of proteinase K digestion protein (virus particles), making the release efficiency of virus RNA one level lower. Secondly, in the process of phenol extraction, Deliberately lowering the pH (the purpose is to remove the DNA, I personally think that raising the pH will help the recovery efficiency of the viral RNA, after all, the host's DNA does not interfere with the amplification of the viral RNA), causing a part of the viral RNA to be lost with the interphase precipitation . The accumulation of two unfavorable factors is the main reason for the low efficiency of Trizol reagent in extracting viral RNA.

 

In fact, Trizol reagent is not the best choice for virus RNA extraction, but the advantage is that it can be obtained by almost all molecular biology laboratories. When the Trizol reagent is used for the detection of new coronavirus RNA, it should be difficult to achieve a sensitivity of 102 copies/ml. If the results of the Trizol reagent to detect some samples are similar to this experiment (the line lying down), it is recommended to use the Trizol reagent Supplement Carrier RNA, or purchase a viral nucleic acid purification kit for retesting (here, insert the viral nucleic acid extraction and purification kit selection guide: some viral nucleic acid extraction kits without Carrier RNA are much less sensitive than viruses with Carrier RNA Nucleic acid extraction kits, please choose carefully) to avoid missed detection or misjudgment of positive samples.